Review



primer s-30  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Promega primer s-30
    Primer S 30, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+s-30/primer+s+30/pmc03866770-85-4-13
    Average 90 stars, based on 1 article reviews
    primer s-30 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: Isolation of Bacillus amyloliquefaciens Strains with Antifungal Activities from Meju
    Article Snippet: RAPD-PCR was done using S-30 (5′-GTGATCGCAG-3′) primer and Go Taq green master mix (Promega, Madison, WI, USA), as described previously ( ).



    Similar Products

    primer premier 5 0 software  (ATCC)
    95
    ATCC primer premier 5 0 software
    Primer Premier 5 0 Software, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+s-30/Dulbecco's+PBS+w%2Fo+Ca+or+Mg/pm28334247-58-14-21
    Average 95 stars, based on 1 article reviews
    primer premier 5 0 software - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    sense primer vhcc s-sr (9.14 mg/mmol) (50 cca tgg cac ata tga gca caa atc cta aac 30)  (Thermo Fisher)
    90
    Thermo Fisher sense primer vhcc s-sr (9.14 mg/mmol) (50 cca tgg cac ata tga gca caa atc cta aac 30)
    Sense Primer Vhcc S Sr (9.14 Mg/Mmol) (50 Cca Tgg Cac Ata Tga Gca Caa Atc Cta Aac 30), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+s-30/Custom+Primer%2C+Special+Handling/pm23618172-44-22-60
    Average 90 stars, based on 1 article reviews
    sense primer vhcc s-sr (9.14 mg/mmol) (50 cca tgg cac ata tga gca caa atc cta aac 30) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    primer s-30  (Promega)
    90
    Promega primer s-30
    Primer S 30, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+s-30/primer+s+30/pmc03866770-85-4-13
    Average 90 stars, based on 1 article reviews
    primer s-30 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    the forward primer alb-s (50-gctg tcatctcttgtgggctgt-30)  (Millipore)
    90
    Millipore the forward primer alb-s (50-gctg tcatctcttgtgggctgt-30)
    The Forward Primer Alb S (50 Gctg Tcatctcttgtgggctgt 30), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+s-30/the+forward+primer+alb+s++50+gctg+tcatctcttgtgggctgt+30+/pm17657714-50-19-13
    Average 90 stars, based on 1 article reviews
    the forward primer alb-s (50-gctg tcatctcttgtgggctgt-30) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    (1) s ize ense terminal primer: 50-caccattatcgtttcag-30  (Promega)
    90
    Promega (1) s ize ense terminal primer: 50-caccattatcgtttcag-30
    (1) S Ize Ense Terminal Primer: 50 Caccattatcgtttcag 30, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+s-30/+1++s+ize+ense+terminal+primer++50+caccattatcgtttcag+30/10__1097_slash_qad__0b013e3280118fb6-39-11-28
    Average 90 stars, based on 1 article reviews
    (1) s ize ense terminal primer: 50-caccattatcgtttcag-30 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    50 actttattgtcatagtttagatctattttg 30 primer s  (New England Biolabs)
    86
    New England Biolabs 50 actttattgtcatagtttagatctattttg 30 primer s
    50 Actttattgtcatagtttagatctattttg 30 Primer S, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+s-30/pm15533824-107-17-20
    Average 86 stars, based on 1 article reviews
    50 actttattgtcatagtttagatctattttg 30 primer s - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    gapdh-specific primers (sense (s): 50- gtcgtattgggcgcctggtcac-30; anti-sense (as): 50-cacgacgtact cagcgccagca-30)  (MJ Research)
    90
    MJ Research gapdh-specific primers (sense (s): 50- gtcgtattgggcgcctggtcac-30; anti-sense (as): 50-cacgacgtact cagcgccagca-30)
    Gapdh Specific Primers (Sense (S): 50 Gtcgtattgggcgcctggtcac 30; Anti Sense (As): 50 Cacgacgtact Cagcgccagca 30), supplied by MJ Research, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+s-30/gapdh+specific+primers++sense++s+++50++gtcgtattgggcgcctggtcac+30++anti+sense++as+++50+cacgacgtact+cagcgccagca+30+/pm14973505-55-16-27
    Average 90 stars, based on 1 article reviews
    gapdh-specific primers (sense (s): 50- gtcgtattgggcgcctggtcac-30; anti-sense (as): 50-cacgacgtact cagcgccagca-30) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results